Journal: Redox Biology

Article Title: Nuclear pore complex dysfunction drives TDP-43 pathology in ALS

doi: 10.1016/j.redox.2025.103824

Figure Lengend Snippet: ALS is associated to altered nucleoporin content in spinal cord and brain cortex . A) Left panel shows a representative western-blot image of FG-repeats containing NUPs (reactive to monoclonal antibody MAb414) of lumbar spinal cord homogenates from ALS patients and healthy, age and sex matched controls. Right panel shows the quantified immunoreactivity. B) The left panel shows representative confocal microscopy images from isolated nuclei from spinal cord samples, quantified in the violin plots from the right panel, demonstrating in situ decreased nucleoporin content.C) Quantitative analyses of NUP107, FG-repeats, and NUP93 in isolated nuclei by flow cytometry analyses, showing decreased content of NUP107 in spinal cord samples from ALS patients. D) RNA Seq data in heatmap showing that the mRNAs content of scaffold NUPs and NUP153 (an FG-repeat containing NUP) was decreased in spinal cord from ALS patients.Right panel indicates TPM (transcrits per kilobase million). E) Left panel shows confocal microscopy images with anti-tubulin β III immunoreactivity in nuclei isolated from brain cortex (area 8) from ALS patients and healthy individuals. Middle panel indicates tubulin β III content distribution, with the vertical line situating median values. Right panel illustrates differences in relationship between the content of FG-repeat NPC and tubulin β III in nuclei, with reference to ALS and tubulin β III content. F) Left panel shows representative confocal microscopy images from isolated nuclei from spinal cord samples, quantified plots from the right panel, demonstrating a decreased amount of nuclei from neuronal cells, based on NeuN content. Bars show mean values ± SEM or % in F. ∗,∗∗, and ∗∗∗∗ indicate p < 0.05, p < 0.01 and p < 0.0001 with reference to control values by Student's T test, Chi-Square (F) or Mann-Whitney U test. In E) For controls, linear relationship equation Y = −0.2721∗X + 0.01782 (p < 0.0004) and for ALS, the equation is Y = 0.3195∗X + 0.008008 (p < 0.0001). Scale white bar length in B, E and F are 50 μm long. Ns: non statistically significant differences.

Article Snippet: To investigate the role of specific NUPs, CRISPR/Cas9 constructs targeting NUP107 were designed using guide RNAs against human NUP107 gene (Santa Cruz Biotechnology, Dallas, TX, US, Cat #sc-405252-KO-2).

Techniques: Western Blot, Confocal Microscopy, Isolation, In Situ, Flow Cytometry, RNA Sequencing, Control, MANN-WHITNEY

Journal: Redox Biology

Article Title: Nuclear pore complex dysfunction drives TDP-43 pathology in ALS

doi: 10.1016/j.redox.2025.103824

Figure Lengend Snippet: NUPs are present in motor neurons and glial cells in human lumbar spinal cord, ventral horn. Representative immunohistochemical images of cellular distribution of the scaffolding NUP TPR (A–D) and the FG-repeat NUP107 (E,F). Samples from grey matter are shown in A,B,E and F, while as white matter cells (i.e. glial cells) are shown in C and D. Samples from healthy donors (A,C and E) and ALS patients (B,D and F) are presented. Arrows in A and B indicate non-nuclear staining of TPR, which were more frequent in ALS samples.

Article Snippet: To investigate the role of specific NUPs, CRISPR/Cas9 constructs targeting NUP107 were designed using guide RNAs against human NUP107 gene (Santa Cruz Biotechnology, Dallas, TX, US, Cat #sc-405252-KO-2).

Techniques: Immunohistochemical staining, Scaffolding, Staining

Journal: Redox Biology

Article Title: Nuclear pore complex dysfunction drives TDP-43 pathology in ALS

doi: 10.1016/j.redox.2025.103824

Figure Lengend Snippet: NUP107 silencing alters autophagy and induces TDP-43 pathology in human cells . A) Left panel indicates representative western-blot of different NUPs in CRISPR-mediated NUP-107 silencing of HEK293 cells. Right panel shows densitometry analyses of different experiments. B) Left panel shows representative western-blot of different autophagy and protein-turnover components in the same cells, with right panel indicating densitometric analyses. C) Confocal microscopy of TDP-43 immunoreactivity of HEK293 CRISPR-mediated NUP107 cells, showing altered TDP-43 immunoreactivity, quantified in the lower panel.D) Confocal microscopy of phospho-TDP-43 immunoreactivity of CRISPR-mediated NUP107-silenced HEK293 cells, showing altered TDP-43 immunoreactivity, quantified in lower panel microscopy. E) Western-blot analyses of TDP-43 and phospho-TDP-43 in CRISPR-mediated NUP107-silenced HEK293 cells, quantified in the right panel. F) Higher magnification of confocal microscopy images showing cytosolic aggregates of phospho-TDP-43 (yellow arrows) induced by CRISPR-mediated NUP107-silencing in HEK293 cells, quantified in the left panel (both size and number of phospho-TDP-43 aggregates). G)Left panel, representative western-blot analyses of NUPs and autophagy components in siRNA-mediated silencing of NUP107 in HeLa cells.Right panel shows the quantitative analyses. Bars show mean values ± SEM from N = 3–5 different experiments. ∗,∗∗, ∗∗∗ and ∗∗∗∗ indicate, respectively, p < 0.05, p < 0.01, p < 0.001 and p < 0.0001 significant differences between silenced or non silenced cells by Student's T test or Mann Whitney U test. In B and D, white scale bar lenght is 50 μm long and 30 μm in F. ns: non statistically significant differences.

Article Snippet: To investigate the role of specific NUPs, CRISPR/Cas9 constructs targeting NUP107 were designed using guide RNAs against human NUP107 gene (Santa Cruz Biotechnology, Dallas, TX, US, Cat #sc-405252-KO-2).

Techniques: Western Blot, CRISPR, Confocal Microscopy, Microscopy, MANN-WHITNEY

Journal: Redox Biology

Article Title: Nuclear pore complex dysfunction drives TDP-43 pathology in ALS

doi: 10.1016/j.redox.2025.103824

Figure Lengend Snippet: Loss of TDP-43 induces alteration in nucleoporin homeostasis. A) Representative immunofluorescence analyses showing NUP107 and MAb414 in TDP-43 silenced cells for a HeLa inducible silencing clone. B) Violin plot showing the quantitative analyses of nuclear (i.e. colocalizing with DAPI) content of NUP107 and MAb414 of cells in A. C) Left panel, western-blot analyses of TPR-content in HeLa cells with inducible TDP-43 silencing, with right panel showing quantitative analyses. D) Western-blot analyses of selected NUPs and LC3B in HeLA cells with doxycycline-inducible TDP-43 silencing under autophagy induction by 24 h of nutrient deprivation (Depriv). E) Quantitative analyses of western-blots shown in D. Bars show mean values ± SEM from N = 3–5 different experiments. ∗,∗∗, and ∗∗∗∗ indicate, respectively, p < 0.05, p < 0.01, and p < 0.0001 significant differences between silenced or non silenced cells by Student's T test, Mann Whitney U test or post-hoc LSD after two-way ANOVA. In A white scale bar lenght is 50 μm long. ns: non statistically significant differences.

Article Snippet: To investigate the role of specific NUPs, CRISPR/Cas9 constructs targeting NUP107 were designed using guide RNAs against human NUP107 gene (Santa Cruz Biotechnology, Dallas, TX, US, Cat #sc-405252-KO-2).

Techniques: Immunofluorescence, Western Blot, MANN-WHITNEY

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A)Top panel, a schematic showing the strategy of generating Pten/Kdm5b mutant mice. Bottom panel, the actual sizes of representative biopsies of anterior prostates (AP) from Wt, Ptenpc–/–, Kdm5bpc–/–, and Ptenpc–/–; Kdm5bpc–/– mice at 6 months of age. (B) Quantification of AP weights from indicated genotypes of mice at 6 months of age. The averages of AP weight and numbers of mice for each cohort are indicated. (C) H&E staining of AP from indicated genotypes of mice at 6 months of age (Magnification: 4X and 20X). (D) Comparison of the onset of PIN in prostate glands between Ptenpc–/– and Ptenpc–/–; Kdm5bpc–/– mice. Error bars represent means ± SD (3 mice/group).

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Mutagenesis, Staining, Comparison

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) Immunohistochemical (IHC) staining for pAKT(S473), Ki67 and TUNEL in prostate tissues from indicated genotypes of mice at 6 months of age (Magnification: 20X). (B) Quantification of the prostate cells positive for pAKT(S473), Ki67 and TUNEL in (A). Error bars represent means ± SD from 3 mice for each group. (C) Western blotting analysis of protein levels of Pten, Kdm5b, pAKT, P110α, and P85 in prostate tissues of mice with indicated genotypes. Two mouse prostate samples for each genotype. (D) Quantification of protein levels for pAKT, P110α, and P85 between Pten/Kdm5b double null and Pten null mice. Error bars represent means ± SD of triplicates.

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Immunohistochemical staining, Immunohistochemistry, TUNEL Assay, Western Blot

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) Western blotting analysis showing the increased levels of P110α and pAKT (Ser473/Thr308) in BHPrE1 cells upon KDM5B overexpression. (B) Quantification of the levels for P110α and pAKT in BHPrE1 cells from (A). (C) Western blotting analysis showing that the effects of KDM5B restoration on the levels of P110α, P85 and pAKT (Ser473/Thr308) in LNCaP KDM5B-KO cells. (D) Quantification of the protein levels for pAKT, P110α and P85 in LNCaP KDM5B-KO cells from (C). (E) Western blotting analysis showing the differential responses between PC3 KDM5B-KO and the parental control cells to IGF-1 stimulation. (F) Quantification of protein levels for pAKT (Ser473/Thr308), P110α, and P85 in (E). Error bars represent means ±SD of triplicates.

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Western Blot, Over Expression, Control

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) Effects of Kdm5b inactivation on the cell proliferation of MEFs. Error bars represent means ± SD of triplicates. (B) Western blotting analysis of protein levels of Pten, Kdm5b, pAKT, P110α, P85, and β-galactosidase in MEFs with indicated genotypes. (C) Quantification of protein levels for pAKT, P110α, P85, and β-galactosidase between Pten/Kdm5b double null and Pten null MEFs. Error bars represent means ±SD of triplicates. (D) Immunofluorescence (IF) images showing the levels and membrane localization of PIP3 in MEFs with indicated genotypes. (E) Quantification of fluorescence intensities for PIP3 levels in MEFs. Error bars represent means ± SD (20 cells/ group). (F) Images showing the β-galactosidase staining in senescent MEFs. (G) Quantification of the MEFs positive for β-galactosidase. Error bars represent means ± SD (30 cells/ group).

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Western Blot, Immunofluorescence, Membrane, Fluorescence, Staining

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) Left panel, western blotting analysis showing the protein levels of KDM5B, pAKT, P110α, and P85 in LNCaP KDM5B-KO and the parental control human PCa cells. Right panel, quantification analysis of pAKT, P110α, and P85 in LNCaP KDM5B-KO and the control cells. (B) A comparison of the cell proliferation between LNCaP KDM5B-KO and the control cells. (C) Immunofluorescence (IF) images and analysis of PIP3 in LNCaP KDM5B-KO cells. Left panel, IF images showing the levels and membrane localization of PIP3 in LNCaP KDM5B-KO cells and the control cells. Right panel, quantification of the fluorescence intensities of PIP3 in LNCaP KDM5B-KO and the control cells. Error bars represent means ± SD (20 cells/group). (D) RNA-Seq peaks showing the changes of KDM5B, IRS1, PIK3CA, and PIK3R1 expression between LNCaP KDM5B-KO and the control cells. (E) Quantitative RT-PCR analysis to show the relative mRNA levels of IRS1, PIK3CA, and PIK3R1 in LNCaP KDM5B-KO cells. (F) Top panel, western blotting analysis showing the protein levels of KDM5B, P110α and P85 in LNCaP KDM5B-KO and the control cells at indicated time points in CHX chase experiments. Bottom panel, quantification of protein remaining for P110α and P85 at indicated time points in KDM5B-KO and the control cells.

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Western Blot, Control, Comparison, Immunofluorescence, Membrane, Fluorescence, RNA Sequencing, Expressing, Quantitative RT-PCR

Journal: Cancer research

Article Title: KDM5B is essential for the hyper-activation of PI3K/AKT signaling in prostate tumorigenesis

doi: 10.1158/0008-5472.CAN-20-0505

Figure Lengend Snippet: (A) A schematic showing the positions of 5 amplicons relative to the PIK3CA transcription start site (TSS). (B) ChIP analysis of KDM5B levels at the indicated regions near PIK3CA TSS in LNCaP KDM5B-KO and the parental control cells. (C) ChIP analysis of H3K4me3 levels at the indicated regions near PIK3CA TSS in LNCaP KDM5B-KO and the control cells. (D) Top panel, a schematic showing that KDM5B regulates the transcription of PIK3CA through affecting promoter activities. Bottom panel, comparisons of luciferase activities of the PIK3CA promoter between LNCaP KDM5B-KO cells and the parental control cells. (E) Luciferase activities showing the effects of KDM5B restoration on the PIK3CA promoter activities in LNCaP KDM5B-KO cells.

Article Snippet: Three different single-guide RNA (sgRNA) sequences against KDM5B (sgRNA1: 5’ TCGAAGACCGGGCACTCGGG 3’, sgRNA2: 5’ GGACTTATTTCAGCTTAATA 3’, sgRNA3: 5’ CCTCCAATTCATTCAGTCTC 3’) were purchased from GenScript. pLentiCRISPR v2 plasmids containing KDM5B-sgRNA sequences, along with lentiviral packaging vectors PsPax2 and envelope plasmid pMD2.g, were transfected into HEK-293T cells using Lipofectamine 2000 (Invitrogen). pLentiCRISPR v2 empty vector was used as the control.

Techniques: Control, Luciferase

Journal: Cancer cell

Article Title: Comprehensive Molecular Characterization Identifies Distinct Genomic and Immune Hallmarks of Renal Medullary Carcinoma

doi: 10.1016/j.ccell.2020.04.002

Figure Lengend Snippet: (A) Tukey boxplots of non-synonymous mutation load per genome for different tumor types. Tumor types are ordered by their median mutation load. RMC samples are highlighted in red. For each boxplot, the central rectangle spans the interquartile range (IQR), the segment within the rectangle shows the median, and the upper and lower whiskers respectively extend the upper and lower hinges of the rectangle by 1.5 * IQR. Black dots represent outliers outside 1.5 * IQR from each hinge. Abbreviations are detailed in the STAR Methods sections. (B) Arm-level copy number alterations in untreated primary RMC tumors. Blue corresponds to loss of one copy, red corresponds to a gain, and dark gray corresponds to more complex alterations shown in detail in Figure S2. (C) Genome plot of RMC4T. In the bottom two panels, the thick black line indicates the median value, blue bars indicate the interquartile range, and red lines indicate segmented values. Loss of heterozygosity is noted on chromosome 22 encompassing the SMARCB1 locus. (D & E) Regions of focal deletion (left) and amplification (right) identified by GISTIC analysis in untreated primary RMC (D) and rhabdoid (E) tumors. G-scores (top X axis) and q values (bottom X axis) are shown. Regions with q values of less than 0.20 (as delineated by the vertical green line) are considered to be significantly aberrant. Only focal copy number alterations (shorter than half the length of a chromosome arm) are shown. (F) Gene Ontology (GO) analysis of genes within regions of recurrent copy number alterations in RMC. See also Figure S1–S3, and Table S2.

Article Snippet: CRISPR/Cas9 knockout Knockout of SMARCB1 was achieved by lentivirus generated in HEK-293FT cells using pLentiCRISPR v2 plasmids harboring gRNA sequences against SMARCB1 obtained from Genscript (Piscataway, NJ, USA).

Techniques: Mutagenesis, Amplification

Journal: Cancer cell

Article Title: Comprehensive Molecular Characterization Identifies Distinct Genomic and Immune Hallmarks of Renal Medullary Carcinoma

doi: 10.1016/j.ccell.2020.04.002

Figure Lengend Snippet: (A) WES chromosome plot showing chromosome 22 monosomy in sample MED1T. In the bottom two panels, the thick black line indicates the median value, blue bars indicate the interquartile range, and red lines indicate segmented values. (B) MLPA analysis of MED1T confirmed the heterozygous deletion present around the SMARCB1 locus. The heterozygous deletions noted on chromosomes 15 and 16 (CSK and FANCA probes, respectively) were also detected in the WES analysis (Figure S2). (C) CGH profile of MED1T. (D) Break-apart FISH of MED1T confirmed the presence of chromosome 22 monosomy and revealed the presence of a disruptive translocation around the SMARCB1 locus as shown by the separation of the green and orange probes (white arrows) seen inside RMC tumor cells (left image). Two yellow fusion signals (yellow arrows) representing two intact SMARCB1 alleles are noted within the nuclei of normal kidney cells (right image). Scale bar: 10 μm. (E) Sanger sequencing confirmation of the fusion RNA product between exon 3 of SMARCB1 and intron 23 of DCDC2C in the MED1T sample (untreated primary tumor), and of the fusion RNA product exon 1 of SMARCB1 and exon 23 of MYOM1 on both untreated primary tumor (RMC32T) and untreated liver metastasis (RMC32TL) from patient RMC32. (F) Agarose gel electrophoresis of the SMARCB1 fusion products using cDNA from samples RMC32T, RMC32TL, and MED1T. (G) Predicted amino acid sequences of the SMARCB1-DCDC2C fusion product in patient MED1 and of the SMARCB1-MYOM1 fusion product in patient RMC32. See also Table S3.

Article Snippet: CRISPR/Cas9 knockout Knockout of SMARCB1 was achieved by lentivirus generated in HEK-293FT cells using pLentiCRISPR v2 plasmids harboring gRNA sequences against SMARCB1 obtained from Genscript (Piscataway, NJ, USA).

Techniques: Translocation Assay, Sequencing, Agarose Gel Electrophoresis

Journal: Cancer cell

Article Title: Comprehensive Molecular Characterization Identifies Distinct Genomic and Immune Hallmarks of Renal Medullary Carcinoma

doi: 10.1016/j.ccell.2020.04.002

Figure Lengend Snippet: GSEA revealed a significant enrichment for the ATR DNA damage repair pathway in response to replication stress in RMC compared with (A) adjacent normal kidney tissues or (B) CDC. ES, enrichment score; NES, normalized enrichment score; FDR, false discovery rate. (C) Hallmark pathways significantly altered (FDR < 0.1) between RMC and CDC by GSEA analysis. (D & E) Western blots of replication stress and DNA damage response pathways following SMARCB1 rescue (D) or direct siRNA inhibition of c-MYC (E) in RMC2C, RMC219, and other SMARCB1-negative cell lines (G401 and VA-ES-BJ). (F) c-MYC peak differences on the promoter site (boxed in red) of the CDK4 gene in G401 MRT cells re-expressing SMARCB1 or EGFP control. The y-axis represents ChIP-seq read counts normalized to 1 million mapped reads. (G) Fold enrichment in c-MYC relative to negative control (normal rabbit IgG) and normalized with input DNA in RMC2C cells following re-expression of SMARCB1 or empty vector control. CCNE2, CDK4, and ATF4 are established c-MYC transcriptional targets, whereas PRM1 is a spermatogenesis-specific gene that is not regulated by c-MYC and serves as negative control. The values are expressed as mean fold change +/− SEM from triplicates. (H) Dot plot of DNA fiber tract lengths indicating a replication speed of ~0.39 kb/min in HEK293-control gRNA cells compared with ~0.51 kb/min in SMARCB1 knock-out cells. Bars (pink) represents the mean of replication tracts (n=187–291, from biological replicas). Top, experimental labeling scheme. Bottom, representative fibers (original magnification x40). See also Figure S6, Table S4, and Table S6.

Article Snippet: CRISPR/Cas9 knockout Knockout of SMARCB1 was achieved by lentivirus generated in HEK-293FT cells using pLentiCRISPR v2 plasmids harboring gRNA sequences against SMARCB1 obtained from Genscript (Piscataway, NJ, USA).

Techniques: Western Blot, Inhibition, Expressing, Control, ChIP-sequencing, Negative Control, Plasmid Preparation, Knock-Out, Labeling

Journal: Cancer cell

Article Title: Comprehensive Molecular Characterization Identifies Distinct Genomic and Immune Hallmarks of Renal Medullary Carcinoma

doi: 10.1016/j.ccell.2020.04.002

Figure Lengend Snippet: (A) Viability curves and half maximal inhibitory concentrations (IC50) of SMARCB1-negative (RMC2C, RMC219, G401, CHLA-06-ATRT) and SMARCB1-positive (786-O, RCC4, A-498) cell lines after 120-hour exposure to the PARP inhibitors olaparib and niraparib. (B) Viability curves and IC50 of SMARCB1-negative cell lines after exposure to the ATR inhibitors VX970 and AZD6738 and to the WEE1 inhibitor adavosertib. (C & D) Viability of RMC2C, RMC219, G401, and VA-ES-BJ cells expressing doxycycline-induced SMARCB1 or empty vector control (C) or treated with siRNA against c-MYC or sham control (D) followed by 120-hour exposure to olaparib (10 μM), niraparib (10 μM), VX970 (1 μM), AZD6738 (1 μM), or adavosertib (1 μM). * p < 0.05, ** p < 0.01 by unpaired two-tailed Welch’s t-test. All results in A-D are presented as means ± SEM from triplicates. (E) In vivo antitumor effect of niraparib, AZD6738, and their combination in the RMC2X PDX mouse model (n=5 mice / group). Plots represent mean percentage tumor volume change from baseline ± SEM. (F) In vivo antitumor effect of cisplatin alone or in combination with niraparib in RMC tumors (n=10 mice / group). Plots represent mean percentage tumor volume change from baseline ± SEM. (G) Schematic model of the interplay between SMARCB1 loss and CNAs in inducing replication stress and inflammatory responses in RMC. Loss of SMARCB1 and gain of 8q promote MYC-induced replication stress which renders RMC cells susceptible to DNA damaging agents such as platinum salts, topoisomerase inhibitors, and nucleoside analogs. DNA damage repair (DDR) pathways induced by replication stress can be directly targeted by DDR inhibitors. The inflammatory responses activated via cGAS-STING signaling in RMC upregulate immune checkpoints that can be therapeutically targeted. See also Figure S7 and Table S7.

Article Snippet: CRISPR/Cas9 knockout Knockout of SMARCB1 was achieved by lentivirus generated in HEK-293FT cells using pLentiCRISPR v2 plasmids harboring gRNA sequences against SMARCB1 obtained from Genscript (Piscataway, NJ, USA).

Techniques: Expressing, Plasmid Preparation, Control, Two Tailed Test, In Vivo

Journal: Cancer cell

Article Title: Comprehensive Molecular Characterization Identifies Distinct Genomic and Immune Hallmarks of Renal Medullary Carcinoma

doi: 10.1016/j.ccell.2020.04.002

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: CRISPR/Cas9 knockout Knockout of SMARCB1 was achieved by lentivirus generated in HEK-293FT cells using pLentiCRISPR v2 plasmids harboring gRNA sequences against SMARCB1 obtained from Genscript (Piscataway, NJ, USA).

Techniques: Control, Virus, Recombinant, Library Quantification, DNA Methylation Assay, Empire Assay, Imaging, Sequencing, Plasmid Preparation, Software

Journal: Blood Advances

Article Title: Targeting IGF2BP3 enhances antileukemic effects of menin-MLL inhibition in MLL-AF4 leukemia

doi: 10.1182/bloodadvances.2023011132

Figure Lengend Snippet: IGF2BP3 knockdown increases sensitivity of MLL-r leukemia cells to menin-MLL inhibition. (A) Western blot analysis showing IGF2BP3 knockdown in RS4;11, NALM6, and SEM cell lines and MLL-Af4 Lin – cells (using I3KO sgRNA targeting human and mouse genes and NT guide). (B) Western blot analysis showing IGF2BP3 expression in MI-503 treated MLL-Af4 Lin – cells depleted (I3KO) or nondepleted for IGF2BP3 (NT). Cells were treated with MI-503 (0.2 μM, 1.0 μM, or DMSO control) for 4 days. (C-E) Dose-response curves from cell viability assays, using CellTiterGlo, of human B-ALL cell lines, SEM, RS4;11, and NALM6, depleted (I3KO) vs nondepleted (NT) for IGF2BP3 treated with menin-MLL inhibitors (MI-503, MI-463, and MI-538) for 4 days. Viability has been normalized to DMSO control-treated cells not depleted for IGF2BP3 (NT DMSO); mean ± standard deviation (SD); n = 6. (F) Dose-response curves from cell viability assays, using CellTiterGlo, of MLL-Af4 Lin – cells depleted for IGF2BP3 (I3KO) vs nondepleted (NT) treated with menin-MLL inhibitors for 4 days. Viability has been normalized to DMSO control-treated cells not depleted for IGF2BP3 (NT DMSO); mean ± SD; n = 6. (G) Increased caspase 3/7 activity of MI-503 treated MLL-Af4 Lin – cells depleted for IGF2BP3 (I3KO) vs nondepleted (NT). Cells treated with MI-503 for 4 days at various concentrations for dose response. Caspase 3/7 activity measured using Caspase-Glo 3/7 and normalized to the activity of DMSO-treated control; mean ± SD, n = 3. (H) Increased annexin V positivity in MLL-Af4 Lin – I3KO cells (vs NT) and with MI-503 treatment (vs DMSO control); mean ± SD; n = 3 (1-way analysis of variance [ANOVA] with Bonferroni multiple comparisons test; ∗∗ P < .01; ∗∗∗∗ P < .0001). (I-J) Histograms from representative samples for annexin V staining, analyzed by flow cytometry. kDa, kilodalton.

Article Snippet: Single-guide RNAs against human IGF2BP3 and nontargeting guides were cloned into pLKO.sgRNA.EFS.tRFP (Addgene 57823).

Techniques: Knockdown, Inhibition, Western Blot, Expressing, Control, Standard Deviation, Activity Assay, Staining, Flow Cytometry

Journal: Blood Advances

Article Title: Targeting IGF2BP3 enhances antileukemic effects of menin-MLL inhibition in MLL-AF4 leukemia

doi: 10.1182/bloodadvances.2023011132

Figure Lengend Snippet: Combined IGF2BP3 knockdown and menin inhibition increases differentiation of MLL-Af4 leukemia. (A) Total colony numbers of MI-503–treated MLL-Af4 Lin – cells, depleted (I3KO) or nondepleted (NT) for IGF2BP3. MLL-Af4 Lin – NT and I3KO cells were treated with MI-503 0.5 μM for 4 days and seeded in methylcellulose colony formation assays at various initial seeding densities and cultured for 10 days. (B,C) Total colony number was reduced with both I3KO and MI-503 treatment at 0.5 μM (B) and 0.5 μM (C) in methylcellulose colony formation assays at initial seeding density of 2500. (D) Proportion of CFU-GM colonies are decreased with both I3KO and MI-503 (at 0.5 μM). (E-F) Proportion of CFU-G and -M colonies are increased with both I3KO and MI-503 (at 0.5 μM). (G-I) Lin – , c-kit + , and Lin – c-kit + cells are decreased with both I3KO and MI-503. MLL-Af4 Lin – NT and I3KO cells were treated with MI-503 0.5 mM for 7 days and then analyzed by flow cytometric immunophenotyping; mean ± SD, n = 3; 1-way ANOVA with Bonferroni multiple comparison’s test (∗ P < .05; ∗∗ P < .01; ∗∗∗ P < .001; ∗∗∗∗ P < .0001). (J-M) Corresponding representative flow cytometry plots of MLL-Af4 Lin – NT and I3KO cells treated with MI-503 (or DMSO control), showing expression of c-kit and Lin markers. (N) Decreased CD34 expression by mean fluorescence intensity with I3KO; mean ± SD; n = 3; student t test, ∗ P < .05. (O) Decreased CD16/32 expression by mean fluorescence intensity with MI-503 treatment; mean ± SD; n = 3; Student t test, ∗∗ P < .01. (P-Q) Corresponding representative flow cytometry plots of MLL-Af4 Lin – NT and I3KO cells treated with MI-503 (or DMSO control), showing expression of CD16/32 and CD34. CFU-GM, granulocyte-macrophage colony-forming units; CFU-G, granulocyte colony-forming units; CFU-M, macrophage colony-forming units; MFI, mean fluorescence intensity; prop, proportion.

Article Snippet: Single-guide RNAs against human IGF2BP3 and nontargeting guides were cloned into pLKO.sgRNA.EFS.tRFP (Addgene 57823).

Techniques: Knockdown, Inhibition, Cell Culture, Flow Cytometry, Control, Expressing, Fluorescence

Journal: Blood Advances

Article Title: Targeting IGF2BP3 enhances antileukemic effects of menin-MLL inhibition in MLL-AF4 leukemia

doi: 10.1182/bloodadvances.2023011132

Figure Lengend Snippet: Increased upregulation of genes involved in differentiation with IGF2BP3 knockdown and menin-MLL inhibition in MLL-Af4 leukemia. (A) Volcano plots of differentially expressed genes with IGF2BP3 knockdown (top) and with MI-503 treatment (left) in MLL-Af4 Lin – NT cells, using DESeq analysis on RNA-sequencing samples from MLL-Af4 Lin – NT or I3KO cells treated with MI-503 1.0 μM or DMSO vehicle. (B) Venn diagram of shared differentially expressed genes with IGF2BP3 knockdown and MI-503 treatment in MLL-Af4 Lin – NT cells. (C) Volcano plots of differentially expressed genes with IGF2BP3 knockdown (top) and with MI-503 treatment (left) in MLL-Af4 Lin – I3KO cells, using DESeq analysis on RNA-sequencing samples from MLL-Af4 Lin – NT or I3KO cells treated with MI-503 1.0 μM or DMSO vehicle. (D) Overlap between differentially expressed genes with MI-503 in MLL-Af4 Lin – NT or I3KO cells and with IGF2BP3 knockdown and known MLL-AF4 ChIP targets from previously published data sets in SEM and RS4;11 and known IGF2BP3 eCLIP targets from previously published data sets of MLL-Af4 CD11b + and MLL-Af4 Lin – cells. P values calculated using Fisher exact test. (E) Pathway enrichment for upregulated genes with IGF2BP3 knockdown using Metascape analysis webtool on MLL-Af4 Lin − IGF2BP3 DESeq data set with an adjusted P < .05 cutoff. (F) Pathway enrichment for upregulated genes with MI-503 treatment using Metascape analysis webtool on MLL-Af4 Lin − NT MI-503 DESeq data set with an adjusted P < .05 cutoff. FC, fold change.

Article Snippet: Single-guide RNAs against human IGF2BP3 and nontargeting guides were cloned into pLKO.sgRNA.EFS.tRFP (Addgene 57823).

Techniques: Knockdown, Inhibition, RNA Sequencing

Journal: Blood Advances

Article Title: Targeting IGF2BP3 enhances antileukemic effects of menin-MLL inhibition in MLL-AF4 leukemia

doi: 10.1182/bloodadvances.2023011132

Figure Lengend Snippet: Increased upregulation of genes involved in differentiation with IGF2BP3 knockdown and menin-MLL inhibition in MLL-Af4 leukemia, validated by qRT-PCR. (A-C) MI-503 treatment at 1.0 μM leads to downregulation of Igf2bp3 and known IGF2BP3 targets, Myc and Hoxa9 , in MLL-Af4 Lin – cells. (D-K) Upregulation of genes involved in differentiation with IGF2BP3 knockdown and MI-503 treatment. mRNA expression was measured by qRT-PCR in MLL-Af4 Lin – cells depleted (I3KO) or nondepleted (NT) for IGF2BP3 and treated with MI-503 1.0 μM or DMSO control. Expression shown as fold change from NT DMSO (mean ± SD; n = 2; 1-way ANOVA with Bonferroni multiple comparisons test, ∗ P < .05; ∗∗ P < .01; ∗∗∗ P < .001; ∗∗∗∗ P < .0001).

Article Snippet: Single-guide RNAs against human IGF2BP3 and nontargeting guides were cloned into pLKO.sgRNA.EFS.tRFP (Addgene 57823).

Techniques: Knockdown, Inhibition, Quantitative RT-PCR, Expressing, Control

Journal: Blood Advances

Article Title: Targeting IGF2BP3 enhances antileukemic effects of menin-MLL inhibition in MLL-AF4 leukemia

doi: 10.1182/bloodadvances.2023011132

Figure Lengend Snippet: Combinatorial inhibition of menin-MLL and IGF2BP3 decreases leukemic engraftment and burden and increases survival in vivo. (A) Schematic representation of BM transplantation of MI-503–treated MLL-Af4 Lin – cells, depleted (I3KO) or nondepleted (NT) for IGF2BP3. Cells treated with MI-503 0.5 μM (or DMSO control) for 5 days in vitro were transplanted into CD45.1 recipients after busulfan conditioning. (B) Decreased peripheral blood engraftment of leukemic cells by CD45.2 + percentage with MI-503 treatment and I3KO at D42 (mean ± SD; n = 8 mice per group; 1-way ANOVA with Bonferroni multiple comparison’s test, ∗ P < .05). (C) Decreased proportion of mice with leukemia with MI-503 treatment and IGF2BP3 knockdown, (8 mice per group; Fisher exact test; ∗ P < .05; ∗∗ P < .01). Mice were all evaluated at necropsy at 8.5 weeks after the first mouse developed signs of terminal leukemia. (D-I) Decreased leukemic burden seen with IGF2BP3 knockdown and MI-503 treatment in NT groups, based on total counts, CD11b + counts, and CD45.2 + percentage by flow cytometry in the spleen (D-F) and BM (G-I) (mean ± SD; n = 7-8 mice per group; 1-way ANOVA with Bonferroni multiple comparison’s test, ∗ P < .05; ∗∗ P < .01; ∗∗∗ P < .001; ∗∗∗∗ P < .0001). Mice were all evaluated at necropsy at 8.5 weeks after the first mouse developed signs of terminal leukemia.

Article Snippet: Single-guide RNAs against human IGF2BP3 and nontargeting guides were cloned into pLKO.sgRNA.EFS.tRFP (Addgene 57823).

Techniques: Inhibition, In Vivo, Transplantation Assay, Control, In Vitro, Knockdown, Flow Cytometry

Journal: Blood Advances

Article Title: Targeting IGF2BP3 enhances antileukemic effects of menin-MLL inhibition in MLL-AF4 leukemia

doi: 10.1182/bloodadvances.2023011132

Figure Lengend Snippet: Combinatorial inhibition of menin-MLL and IGF2BP3 increases survival in vivo and is accompanied by concordant changes in gene expression. (A-B) Increased overall survival and leukemia survival with IGF2BP3 knockdown and MI-503 treatment in NT groups (n = 8 mice per group; Kaplan-Meier with log-rank test, ∗ P < .05; ∗∗ P < .01; ∗∗∗ P < .001). Comparisons made vs NT DMSO. Follow-up to 15 weeks with terminal sac of remaining mice. (C) Photomicrographs of Wright-stained BM smears from mice as above; original magnification, ×1000; scale bar, 10 μm. (D-F) Expression of genes of interest in the BM of mice that received transplantation with MI-503–treated MLL-Af4 Lin – NT or I3KO cells was measured by qRT-PCR. MLL-Af4 Lin – cells depleted (I3KO) or nondepleted (NT) for IGF2BP3 were treated with MI-503 0.5 mM (MI-503) or carrier control (DMSO) for 5 days in vitro before transplantation. Mice were euthanized at 8.5 weeks at first signs of the first mouse developing terminal leukemia. Gene expression data shown from selected mice in each group. Shown as fold change from NT DMSO (mean ± SD; n = 2; 1-way ANOVA with Bonferroni multiple comparisons test, ∗ P < .05; ∗∗ P < .01; ∗∗∗ P < .001; ∗∗∗∗ P < .0001).

Article Snippet: Single-guide RNAs against human IGF2BP3 and nontargeting guides were cloned into pLKO.sgRNA.EFS.tRFP (Addgene 57823).

Techniques: Inhibition, In Vivo, Gene Expression, Knockdown, Staining, Expressing, Transplantation Assay, Quantitative RT-PCR, Control, In Vitro

Journal: Oncotarget

Article Title: Expression of MLL-AF4 or AF4-MLL fusions does not impact the efficiency of DNA damage repair

doi: 10.18632/oncotarget.8938

Figure Lengend Snippet: A. , F. Schematic representation of the donor vector used for insertion of the dTo-MA4 A. or A4M-GFP F. cassette into the AAVS1 locus. dTo, dTomato fluorescent protein; SD, splice donor; SA, splice acceptor; CAG, CMV early enhancer/chicken β actin promoter. Black (5′; junction) and green (3′; junction) arrows depict genomic location of primers used to confirm targeted integration. B. , G. Representative images of dTo-MA4- and A4M-GFP-expressing HEK293 cells after puromycin or G418 selection, respectively. C. , H. Targeted integration analysis of MA4 and A4M into the AAVS1 locus by PCR using primers specific for the 5ʹ (top panels) and 3ʹ (bottom panels) integration junctions. D. , I. RNA expression of MA4 D. and A4M I. in antibiotic-selected cells. E. , J. Homologous recombination confirmed by southern blot analysis after BglII digestion of genomic DNA from puromycin/G418-resistant clones using a MA4 probe E. or an AAVS1 exon2 probe outside the targeting construct J. . A 4Kb band represents a targeted integration of MA4 in PPP1R12C. The 8kb band corresponds to the targeted integration of A4M in PPP1R12C. Untargeted allele gives a 12Kb band J. . L. qPCR of the MA4 targets HOXA9 and PROM1 is comparable between HEK293 cells ectopically expressing MA4 upon CRISPR/Cas9-mediated genome edition (left panel) or lentiviral transduction (right panel) * p < 0.05, compared to WT . K. MA4 qPCR comparing B-ALL patients and HEK293-MA4.

Article Snippet: Guide RNA against AAVS1 intron 1 was constructed using the primers AAVS1 Fw 5ʹ-CACCGGGGCCACTAGGGACAGGAT-3ʹ and AAVS1 Rv 5ʹ-AAACATCCTGTCCCTAGTGGCCCC-3ʹ [ ]. pAAVS1.SA-2A-Puro-pA donor vector was obtained from Addgene (plasmid #22075). pAAVS1.SA-2A-Neo-pA was made by replacing puro gene from pAAVS1.SA-2A-Puro-pA using Xho I and Mfe I restriction sites.

Techniques: Plasmid Preparation, Expressing, Selection, RNA Expression, Homologous Recombination, Southern Blot, Clone Assay, Construct, CRISPR, Transduction

Journal: bioRxiv

Article Title: Endothelial-specific Gata3 expression is required for haematopoietic stem cell generation

doi: 10.1101/2021.09.14.460344

Figure Lengend Snippet: ( A) Cell populations sorted and analysed by RNA-Seq. ( B ) Principal Component Analysis (PCA) of individual samples of the 4 cell populations. ( C ) Venn diagrams of genes upregulated and downregulated in Gata-GFP+ ECs and HCs. ( D ) tSNE plots of the 4 cell populations pseudo-coloured for the expression of the indicated genes. ( E ) Cell cycle regulators differentially expressed in Gata3-GFP+ ECs and HCs. ( F ) Percentage of quiescent cells in the Gata3-GFP+/-EC and HC populations. * p<0.05; ** p<0.01; paired t-test. ( G ) tSNE plot pseudo-coloured for the expression of Cdkn1c in the 4 cell populations. ( H ) Percentage of Cdkn1c wild-type and knockout ECs and HCs in the different phases of the cell cycle. * p<0.05; paired t-test. ( I ) Expression of RUNX1C and GATA3 as measure by qPCR in hiPSCs with (+) and without (-) RUNX1C activating specific gRNA as part of the UniSAM endogenous gene activation system. * p<0.05; *** p<0.001; Mann-Whitney test.

Article Snippet: Each well was transfected with the PB-UniSAM plasmid (Addgene 99866 {Fidanza, 2017 #17}) containing either one of the four gRNAs against RUNX1C promoter {Fidanza, 2017 #17} or no guide (Empty vector control).

Techniques: RNA Sequencing Assay, Expressing, Knock-Out, Activation Assay, MANN-WHITNEY